Removing adapters

Because pre-alignment QC shows that the sequencing data have low error likelihood, the next step will be to remove adapter contamination by clicking on the FASTQ file data node, selecting "Pre-alignment tools" and then "Trim adapters". The adapters are stored in the file illumina_multiplex.fa located in the instructor's PartekFlow/uploads/hcc1395/references folder. The content in illumina_multiplex.fa are as follows.

>Multiplexing_Read_1_Sequencing_Primer_3_to_5
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
>Multiplexing_Read_2_Sequencing_Primer_3_to_5
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

The screen recording below shows the steps for adapter trimming. Click on "Configure" under "Advanced options" to adjust the stringency criteria (ie. error rate, minimum overlap) that the trimming will use to determine whether adapter is present in a read/sequence. The minimum length for trimmed read to be kept in the analysis can be adjusted here as well.

Run pre-alignment QC on the adapter trimmed reads before proceeding.